|
Contents
|
1. Constriction of cerebral arteries is considered to depend on L-type voltage-dependent calcium channels (VDCCs), however many previous studies have used antagonists with potential non-selective actions. Our aim was to determine the expression and function of VDCCs in the rat basilar artery.
2. The relative expression of VDCC subtypes was assessed using quantitative PCR and immunohistochemistry and the data were correlated with physiological studies of vascular function. Domains I to II of the T channel subtypes expressed in the rat basilar artery were cloned and sequenced.
3. Blockade of L-type channels with nifedipine had no effect on vascular tone. In contrast, in the presence of nifedipine, hyperpolarization of short arterial segments produced relaxation, while depolarization of quiescent segments evoked constriction.
4. mRNA and protein for L- and T-type VDCCs were strongly expressed in the main basilar artery and side branches, with CaV3.1 and CaV1.2 the predominant subtypes.
5. T-type VDCC blockers, mibefradil, pimozide and flunarizine, decreased intracellular calcium in smooth muscle cells, relaxed and hyperpolarized arteries, while nickel chloride (100 μM) had no effect. In contrast to nifedipine, nimodipine produced hyperpolarization and relaxation.
6. When arteries were relaxed with U73122 (phospholipase-C inhibitor), in the presence of nifedipine, 40 mM KCl evoked depolarization and constriction, which was significantly reduced by mibefradil.
7. Sequencing of domains I-II revealed splice variants of CaV3.1 which may impact on channel activity.
8. We conclude that vascular tone of the rat basilar artery results from calcium influx through nifedipine-insensitive VDCCs with pharmacology consistent with CaV3.1, T-type channels.
Voltage dependent calcium channels (VDCCs) are transmembrane proteins which provide influx of calcium for a variety of intracellular activities in excitable cells. In blood vessels, this calcium entry produces vasoconstriction and blockers of VDCCs have been used to treat cardiovascular disorders. VDCCs consist of different subunits, the α1 subunit, which contains 4 homologous transmembrane domains encompassing the pore, the voltage sensor and the selectivity filter, and the auxiliary subunits β, α2δ and γ. The α1 subunits have been classified as CaV1.1, CaV1.2, CaV1.3, CaV1.4 (L-type VDCCs), CaV2.1 (P/Q-type VDCCs), CaV2.2 (N-type VDCCs), CaV2.3 (R-type VDCCs), CaV3.1, CaV3.2 and CaV3.3 (T-type VDCCs) (see Table 1 for details; for reviews see Perez-Reyes, 20031; Lacinová, 20052). The T-type or transient, rapidly inactivating VDCCs possess a lower membrane potential threshold for activation than the other channel subtypes (∼−70 mV), and hence are called low voltage activated; the remaining seven channels being high voltage activated.2 Interestingly, the T-type currents recorded from many vascular smooth muscles are activated at more positive voltages (−30 to −50 mV) and are inactivated more slowly than those in other tissues.1
Table 1. Subtypes and functional expression of VDCCs.
| Family |
Former name |
Structural nomenclature | Antagonists | Common location |
| L | α1S | CaV1.1 |
Dihydropyridines
e.g. Nifedipine Nisoldipine Nimodipine Phenylalkylamines e.g. Verapamil Benzothiazepines e.g. Diltiazem |
Cardiovascular system |
| α1C | CaV1.2 | |||
| α1D | CaV1.3 | |||
| α1F | CaV1.4 | |||
| P/Q | α1A | CaV2.1 |
ω-agatoxin IVA
ω-agatoxin IVB ω-conotoxin MVIIC |
Brain |
| N | α1B | CaV2.2 |
ω-conotoxin GVIA
ω-conotoxin MVIIA |
|
| R | α1E | CaV2.3 | SNX-482 | |
| T | α1G | CaV3.1 |
Mibefradil
Pimozide Nickel chloride Kurtoxin Flunarizine Nimodipine |
Brain
Cardiovascular system |
| α1H | CaV3.2 | |||
| α1I | CaV3.3 |
Traditionally, it is believed that L-type or long lasting VDCCs control tone of cerebral arteries, such as the basilar artery, as these channels would be open and stay open at the membrane potentials experienced by vascular smooth muscle in vivo (−30 to −50 mV). The most reliable studies have involved the specific L-type VDCC blocker, nifedipine, which decreased agonist-induced vascular tone in the basilar artery of the dog,3-5 rat,6,7 and rabbit,8,9 as well as spontaneously acquired tone in the dog10 and rabbit.11 Nevertheless, nifedipine did not completely reverse agonist-induced contraction of basilar arteries of adult rats,6 dogs4 and rabbits,9 nor did it decrease vascular tone of the basilar artery in young rats.12
Many other studies, in which L-type VDCCs have been suggested to control vascular tone of the basilar artery, have used VDCC blockers such as nimodipine.13-21 Indeed, nimodipine has been the most commonly used dihydropyridine in studies conducted in vivo which have demonstrated control of pial vessel diameter.22 However, nimodipine has been shown to block nifedipine-insensitive VDCCs, in addition to typical L-type channels23-26 and is more potent than nifedipine in decreasing agonist-induced vasoconstriction in cerebral arteries.16,18,27 Together, these data suggest that other VDCCs could be involved in the regulation of cerebrovascular tone and could explain why L-type blockers do not decrease vasoconstriction during vasospasm,5,28 although nimodipine is effective.29
Recently, L, T and N-type VDCCs were identified and electrophysiologically characterized in whole cell patch clamp studies using isolated smooth muscle cells of the dog basilar artery.17 However, isometric tension studies to identify the physiological significance of these currents were inconclusive as they were conducted in the presence of concentrations of nimodipine and mibefradil17 that would have mixed actions on both L and T-type channels.23 The aim of the present study was therefore to investigate the functional significance of VDCC subtypes in the intact rat basilar artery and its smaller side branches, using nifedipine to specifically block L-type VDCCs. We have also determined the relative expression of VDCC subtypes using quantitative PCR and immunohistochemistry and correlated these data with physiological studies of vascular function. Finally, we have cloned and sequenced domains I to II of the T channel subtypes expressed in the rat basilar artery, as previous mutagenesis studies have identified these regions as containing sequences which may alter voltage gating, speed of inactivation and surface expression of the channels.30,31
All experiments were performed in accordance with a protocol approved by the Animal Experimentation Ethics Committee of the Australian National University. Male Wistar rats aged 14-17 days were anaesthetized with ether and euthanized by decapitation. The brain was gently removed and placed in cold isolated vessel dissecting buffer (IVDB) containing (mM): 3 3-(N-morpholino) propanesulphonic acid (MOPS); 1.2 NaH2PO4; 4.6 glucose; 2 pyruvate; 0.02 EDTA(Na); 0.15 albumin; 145 NaCl; 4.7 KCl; 2 CaCl2; 1.2 MgSO4. A rectangular section of the meninges, containing the basilar artery and its main and secondary branches was isolated.
The pia was pinned firmly over the vessels to facilitate stable intracellular impalements. Segments of the primary branch of the basilar artery were cut to lengths of 300-500 μm to enable changes in membrane voltage by current injection. Intracellular voltage recordings were made in continuous current clamp mode (Axoclamp 2B, Axon Instruments, USA), using sharp intracellular microelectrodes (100-200 MΩ, 0.5 M KCl). Resting membrane potential (RMP) was defined as the most negative membrane potential during membrane voltage oscillations. Current application was performed using the single electrode discontinuous current clamp mode and slow switching frequencies of 300Hz. Electrode capacitance was minimized by keeping solution levels low, dipping the electrode tips in silicone and compensated by monitoring the head stage voltage. Hyperpolarizing and depolarizing current steps were applied. Recordings were low-pass filtered (cut off frequency of 100 Hz). Recordings of membrane potential and diameter changes were acquired simultaneously in the region where the cell was impaled at sample rates of 200 Hz. Experiments were performed in Krebs solution at 33-34°C as previously described.12
The pia was gently removed from the arteries, which were pinned in a narrow well created in a sylgard (Dow Corning Corporation, USA) coated coverslip, in a 1 mL recording chamber. Preparations were incubated in 5 μM Fura-2 acetoxymethyl ester (Fura-2 AM) and measurements of changes in intracellular calcium concentration made as previously described.12 Change in calcium concentration was determined by the ratio of the fluorescence emission recorded at 510 nm following alternate 340 and 380 nm excitation (F340/380). In some experiments calcium was measured in the same preparation as intracellular voltage recordings by making a small hole in the overlying pia for access of the Fura-2 AM.
Diameter was simultaneously measured with DIAMTRAK, an edge-tracking computer program.32 When combined with calcium imaging studies, images were collected under infrared illumination (Hamamatsu High Performance Vidicon Camera, Japan).
As there are no highly selective T-type blockers currently available, we have used 3 structurally different drugs, mibefradil, pimozide and flunarizine, which have been shown to block T-type channels.23 Mibefradil blocks T-type currents in vascular smooth muscle (IC50 0.1-0.2 μM), but can inhibit L-type channels at concentrations > 1μM.23 Mibefradil was therefore used at 1 μM as previously shown.33,34 Concentrations of the other drugs were chosen on the basis of T-type channel blockade in other studies: pimozide 10 μM,35,36 flunarizine 100 μM.2,36 Nifedipine was used to block L-type VDCCs (1, 10 μM). NiCl2 (100 μM) was used to differentiate the actions of CaV3.2 channels (IC50 13 μM), from CaV3.1 and CaV3.3 (IC50 250 μM37).
Sources of drugs were: 1-(6-((17β-3-methoxyestra-1, 3,5(10)-trien-17-yl) amino) hexyl)-1H-pyrrole-2,5-dione (U73122; Phospholipase C inhibitor) (BIOMOL, PA USA); nifedipine, nimodipine, mibefradil (Sigma Chemical Co., MO USA); 2-aminoethyldiphenyl borate (2-APB; IP3 receptor inhibitor) (Calbiochem, Germany); nickel chloride (BDH Laboratory Supplies, England), pimozide (Sigma Chemical Co., MO USA), flunarizine (Fluka Biochemika, Switzerland). U73122 was dissolved in IVDB at 2 mM and diluted to 10 μM in Krebs solution. Stock solutions of nifedipine (10 mM) and nimodipine (20 mM) were dissolved in 100% ethanol and 2-APB (60 mM) in DMSO. Appropriate dilutions of ethanol and DMSO in Krebs solution showed no effects on either contractions or depolarizations. Pimozide and flunarizine were dissolved directly in Krebs solution. Other drugs were prepared as ×1000 stocks in distilled water and diluted in Krebs solution. Krebs solution containing 40 mM KCl was prepared by equimolar replacement of NaCl.
Effect of drugs and current steps on resting vessel diameter (RVD), membrane potential and wall calcium was determined relative to values in control solution as previously.12 Data were analysed with paired t-tests for single drugs and with one-way ANOVA followed by t-tests using Bonferroni correction for multiple drug exposure. Values are means ± S.E.M. of n preparations, each from a separate animal. Results were considered significant for p<0.05.
The pia was removed from the blood vessels which were placed in RNAlater (Ambion). Pooled arteries from 13-17 rats (n = 5 samples) were snap-frozen in liquid nitrogen, ground in a cold mortar and resuspended in 600 μL of lysis buffer + 1% β-mercaptoethanol. RNA was isolated using RNeasy minicolumns (Qiagen, USA), including DNase digestion (30 min).
Messenger RNA was reverse transcribed to cDNA (42°C 1h, 50°C 1h, 90°C 10 min) using oligo dT (500 ng/μL, Invitrogen, USA) primers and Superscript II (200 U/μL, Invitrogen). For each sample, reactions from which reverse transcriptase was omitted were run to control for contaminating DNA.
Primers were designed to be complementary to the published rat sequences for each of the pore-forming (α1) subunits of the VDCCs and to include as many known variants as possible. Table 2 contains primer sequences and product sizes. PCR conditions for each primer pair (Table 3) were determined using positive controls for each CaV subtype, i.e. brain cortex for CaV1.2,38 CaV1.3,38 CaV2.2,2 CaV2.3,2 CaV3.1,2 and CaV3.2,39 skeletal muscle for CaV1.1,2 retina for CaV1.4,2 cerebellum for CaV2.1,40 and brain striatum for CaV3.3.41 Reaction mixtures (20 μl) contained 500 nM of each primer (except 250 nM for CaV2.2) (Operon, USA), Taq polymerase (1 U/reaction), dNTPs (200 μM) and 50 ng cDNA template. Products were stained with ethidium bromide after electrophoresis of 2% agarose gels. Every experiment included control reactions which lacked cDNA or contained untranscribed RNA.
Table 2. CaV Primer sequences.| Channel |
PCR Primers 5′-3′
Forward (above), Reverse (below) |
Expected Product
Size |
| CaV1.1 |
CCAATAAGATCCGCGTCCTATGTC
CAAGGATCTGATTCCTCATGGAGT | 146 bp |
| CaV1.2 |
GAAGATTGCCCTGAATGACACCAC
CAGACTCTGGAGCACACTTCTTGC | 160 bp |
| CaV1.3 |
TCCAGCAGGAAATTCGGTGTGTCA
TCGGTCGTGCTTGTAGGAGTAATG | 189 bp |
| CaV1.4 |
AACTGGGCCTAGTGATGATGATGG
AGGGACTTCCTGTTCCTCATTCTG | 186 bp |
| CaV2.1 |
TCAAGAAAGCAGCATGAAGGAGAG
CGCTGTCTGAGTAGCCATCAGTTC | 181 bp |
| CaV2.2 |
TGATGGCACCAGCATCAACCGACA
TTGCCCAGGCAAGACAGCATGATT | 122 bp |
|
CaV2.3
|
TCGGAGTGGATACCCTTCAATGAG
AGCGATTGCTGTTCCTGGAATTGT | 107 bp |
|
CaV3.1
|
AGTCAGGCTCCATCTTGTCCGTTC
TCCAGGGAGTCAGTCCTTATTGCT | 204 bp |
|
CaV3.2
|
CGACCAAGTTCCATGACTGCAACG
CAGCACTTTGTGTAGACGGAAGCA | 145 bp |
| CaV3.3 |
GCACGAGGACTGCAATGGCAGAAT
CCGGAAACACAGGGTATAGTCGAT | 120 bp |
| 3.1 domain I |
TAGCTTCACGCAGCTCAACGACCT
GTGCTAGCATTGGACAGGAATCGT | 1215 bp |
| 3.1 I-II Linker |
CAACACCACCTGTGTCAACTGGAA
AGCCTCCAGAAAGCCAGCACAGAA | 1269 bp |
| 3.1 domain II |
GGCTTTCTGGAGGCTGATCTGTGA
GCTCTTTCGTAGTTCCGCGTGTTC |
856 bp
925 bp |
| 3.2 domain I |
AGCTCTGGCTGCCACAGTCTTCTT
GGTACTGCTGGGATCCACCTTCTT | 1267 bp |
| 3.2 I-II Linker |
ACAACATTGGCTACGCTTGGATTG
TCTGAGCCACTGAATTCAAACTCG | 1069 bp |
| 3.2 domain II |
GTGAGCTGAAGAGCTGCCCATATT
TAGACGTCTTATCCTCGTCGGTGT | 1014 bp |
| Channel | Number of cycles | Annealing | Extension |
| CaV1.1 | 35 | 65°C 10 s | 72°C 10 s |
| CaV1.2 | 35 | 67°C 5 s | 72°C 10 s |
| CaV1.3 | 35 | 67°C 5 s | 72°C 10 s |
| CaV1.4 | 36 | 67°C 10 s | 72°C 10 s |
| CaV2.1 | 35 | 65°C 5 s | 72°C 15 s |
| CaV2.2 | 35 | 67°C 5 s | 72°C 10 s |
| CaV2.3 | 35 | 65°C 10 s | 72°C 20 s |
| CaV3.1 | 35 | 67°C 5 s | 72°C 15 s |
| CaV3.2 | 35 | 67°C 5 s | 72°C 10 s |
| CaV3.3 | 35 | 67°C 10 s | 72°C 10 s |
| CaV3.1 Domains I and II and I-II linker | 40 | 66°C 10 s | 72°C 80 s |
| CaV3.2 Domains I and II and I-II linker | 40 | 66°C 10 s | 72°C 80 s |
The basilar artery was separated from its lateral branches before RNA extraction and reverse transcription. Quantitative PCR was used to determine the absolute copy numbers of VDCC subtypes using standard curves constructed by amplification of known quantities of plasmid DNA containing the cloned PCR products that were detected by semi-quantitative PCR, i.e. CaV1.2, CaV1.3, CaV3.1, CaV3.2, and CaV2.3. Cloned PCR products were confirmed by sequencing (ABI 3730 Capillary Genetic Analyser, ACRF Biomolecular Resource Facility, JCSMR, ANU).
PCR reaction mixtures (25 μL) were prepared using the SYBR Green Core Reagents Kit (Applied Biosystems) and contained 0.6 U of Amplitaq Gold, 800 nM of each primer, 1mM dNTPs, 1X SYBR Green buffer, 3mM MgCl2 and 10 ng cDNA or 5 μL diluted plasmid containing the cloned insert of interest. Duplicate reactions were performed in the ABI Prism 7700 Sequence Detection System (Applied Biosystems) at 95°C for 12 min, 40 cycles of 95°C for 10 s, 67°C for 10s for CaV3.1, CaV1.2, CaV1.3, CaV3.2; 65°C for CaV2.3; and 61°C for 15s for 18S rRNA, followed by 72°C 60s.
The expression of all of the genes was determined in each of 3 samples with appropriate controls as described above. The integrity of each PCR reaction was checked using dissociation curve analysis after every reaction (95°C for 15 s, 60°C for 20 s and 95°C for 15 s).
The copy number in every sample was normalized to expression of 18S rRNA. Results were analyzed for statistical significance (P < 0.05) using one-way analysis of variance (ANOVA) and Student's t-test with Bonferroni correction for multiple comparisons. Expression of the same gene in the basilar artery and its branches was analysed using paired t-tests.
Using primers designed to span domains I, II and I-II linker of CaV3.1 and CaV3.2 (Table 2), cDNA was amplified through PCR using 0.5 U/reaction of HotMaster Taq DNA Polymerase (Eppendorf, Germany) according to the following conditions: 95°C for 2 min, 40 cycles of 95°C for 10 s, 66°C for 10 s, 72°C for 80 s, final cycle of 72°C for 5 min. PCR products were visualized through agarose gel electrophoresis and ethidium bromide staining.
Single amplicons were purified directly from the PCR reaction mix. When multiple amplicons were present, the most strongly amplified bands were purified after electrophoresis, according to the manufacturer’s instructions (QIAquick PCR Purification Kit (QIAGEN, USA). Purified PCR products were ligated into the pCR4-TOPO vector (Invitrogen) and plasmid DNA containing the cloned products isolated (QIAprep miniprep kit, Qiagen, USA).
Both strands of the cloned PCR products of domains I, II and I-II linker of CaV3.1 and CaV3.2 were sequenced on an ABI 3730 sequencer (ACRF Biomolecular Resource Facility). Nucleotide sequences were translated into protein using software provided by the Swiss Institute of Bioinformatics (http://au.expasy.org/tools/dna.html).42 The nucleotide and amino acid sequences of cloned fragments were compared with all publicly available Cav sequences using BLAST software and rat genome sequence data provided by GenBank (http://www.ncbi.nlm.nih.gov). Gene sequences have been deposited in the GenBank database (GenBank accession numbers EF116282, EF116283, EF116284, EF116285, EF116286, EF116287, EF116288, EU293201).
The basilar artery and side branches were processed as wholemounts and incubated overnight at 4°C in rabbit antibodies raised against peptides from Cav3.1 (FVCQGEDTRNITNKSDCAEAS) or Cav3.2 (YYCEGPDTRNISTKAQCRAAH),43 diluted (1:300) in PBS containing 2% bovine serum albumin and 0.2% Triton X100. Similar incubations were made with commercial rabbit antibodies raised against Cav3.1 (1:100; Alomone Labs), Cav3.2 (1:100; Santa Cruz), Cav1.2, Cav1.3 and Cav2.3 (1:300; Alomone Labs). Staining was visualized after incubation for 3h in Cy3 conjugated anti-rabbit IgG (1:100, Jackson Immunoresearch Laboratories). Preparations were subsequently incubated briefly in 0.001% propidium iodide to label cell nuclei. Serial confocal images were taken of the Cy3 staining throughout the cell layers of wholemounts and selected sections recombined to visualise the smooth muscle. Specificity of the staining was tested by omission of the primary antibody or preincubation of the antibody with a ten-fold excess of the immunogenic peptide.
Following a 30 min incubation period, arteries typically exhibited spontaneous vasomotion which was preceded by oscillations in membrane potential and oscillations in the intracellular calcium concentration of individual smooth muscle cells. The L-type VDCC blocker, nifedipine (1 μM), abolished vasomotion (n = 18), oscillations in wall calcium (n = 8) and membrane potential (n = 10), without significantly affecting vascular tone (100.1 ± 0.6 % RVD in control; P > 0.05; paired t-test, n = 18; Table 4). Nifedipine produced depolarization (control: −45.1 ± 2.1 mV; nifedipine: −42.8 ± 2.3 mV; P < 0.05; paired t-test, n = 10), basal calcium levels increased (104.8 ± 1.4 % F340/380 in control; P < 0.05; paired t-test, n = 8; Table 4) and oscillations in calcium in individual smooth muscle cells became asynchronous, as we have described previously.12
A supramaximal concentration of nifedipine (10 μM) produced an effect similar to that of the lower concentration of 1 μM, i.e. vasomotion was abolished, the RMP depolarized significantly (control: −46 ± 2.7 mV; nifedipine −35 ± 1.9 mV; n = 4; P < 0.05) but there was still no loss of vascular tone (96 ± 1.2 % RVD in control, n = 4; P > 0.05; Figure 1 A, B; Table 4). The subsequent addition of nimodipine (10 μM) significantly hyperpolarized (nimodipine: −58 ± 2.0 mV; n = 4; P < 0.05) and relaxed the arteries (108 ± 1.8 % RVD in control, n = 4; P < 0.05; Figure 1C; Table 4).
Table 4. Effect of VDCC blockers on responses of the rat basilar artery| Drug | Vessel Tone | Vasomotion | Basal calcium | Membrane Potential |
| Nifedipine 1μM |
No effect
(18) |
Abolished
(18/18) |
Increased
(8) |
Depolarized
(10) |
| Nifedipine 10μM |
No effect
(4) |
Abolished
(4/4) | ND |
Depolarized
(4) |
| Nifedipine 10μM + Nimodipine 10μM |
Relaxed
(4) |
Abolished
(4/4) | ND |
Hyperpolarized
(4) |
| Mibefradil 1μM |
Relaxed
(13) |
Abolished
(13/13) |
Decreased
(5) |
Hyperpolarized
(5) |
| Pimozide 10μM |
Relaxed
(14) |
Abolished
(9/14) |
Decreased
(6) |
Hyperpolarized
(5) |
| Flunarizine 100μM |
Relaxed
(7) |
Abolished
(5/7) |
Decreased
(7) | ND |
| NiCl2 100μM |
No effect
(10) |
Decreased frequency
(10/10) | ND |
No effect (6) |
Number of experiments in parentheses
ND not determined
Figure 1. Effect of nimodipine on vasomotion, tone and membrane potential. Application of a high concentration (10 μM) of nifedipine abolished vasomotion and membrane potential oscillations, depolarized the arteries but did not affect vascular tone (A, B). The addition of nimodipine (10 μM) to the Krebs solution containing nifedipine, hyperpolarized and relaxed the arteries (C). Dotted lines indicate comparable diameter and membrane potential levels in all traces.
In contrast to the effect of nifedipine, application of small hyperpolarizing current steps (−0.1 to −0.5 nA) to short segments of basilar artery immediately abolished vasomotion (P < 0.05) and produced relaxation (104 ± 0.5 % RVD in control; P < 0.05; paired t-test, n = 20; Figure 2A, B). Relaxations were similar in amplitude irrespective of the size of the current steps (Figure 2A, B) and occurred even for hyperpolarizing steps that took the artery to values around the most negative potential observed during diameter and voltage oscillations (RMP in all experiments: −45.4 ± 0.7 mV; n = 61). Both vasomotion and tone were restored immediately following cessation of the current pulse (Figure 2A, B).
Figure 2. Hyperpolarization abolishes vasomotion and relaxes basilar artery segments. Application of small hyperpolarizing currents to short segments of basilar arteries immediately abolished rhythmical depolarizations and contractions and relaxed the arteries (A, B). Tone and oscillations were re-gained immediately after the current application was stopped. Relaxation was similar in amplitude irrespective of the size of the current steps (A, B). Application of hyperpolarizing current steps relaxed the arterial segments even in the presence of the L-type VDCC blocker nifedipine (C, D). Dotted lines indicate resting vessel diameter or approximate resting membrane potential.
Relaxation was also observed during negative current steps in the presence of nifedipine (10 μM; 103 ± 0.3 % RVD in nifedipine; P < 0.05; paired t-test, n = 6; Figure 2C, D). Relaxation in the presence of nifedipine was not significantly different from that in the absence of nifedipine (compare Figure 2A, B with C, D, respectively; unpaired t-test; P > 0.05).
In some short arterial segments, which were not spontaneously active, application of positive current steps (+0.05 to +0.5 nA) evoked depolarizations which, if large enough, were associated with vasoconstriction (9.0 ± 1.9 % RVD, n=3) and vasomotion (Figure 3A, B). After application of nifedipine (10 μM), vasoconstriction was still observed throughout the current pulse and this was not significantly different from that in control solution (9.2 ± 3.4 % RVD, n=3; P > 0.05, paired t-test). In contrast, vasomotion was not observed under these conditions (Figure 3C, D).
Figure 3. Depolarization induces vasoconstriction of basilar artery segments. Application of depolarizing currents steps to short segments of quiescent basilar arteries evoked vasoconstriction and vasomotion (A, B). In the presence of the L-type VDCC blocker nifedipine, depolarizing current steps evoked vasoconstriction but not vasomotion (C, D).
In order to determine the threshold for vasoconstriction in the presence of nifedipine, arteries were depolarized slowly with 40 mM KCl. In these experiments, vessels were relaxed and hyperpolarized by blocking the phospholipase C pathway with U73122 (10 μM).12 Application of 40 mM KCl Krebs evoked a slow membrane depolarization to −30 ± 3.4 mV (n = 6), and a rise in wall calcium concentration (117 ± 1.2 % F340/380 in U73122 + nifedipine; P < 0.05, n = 4). The membrane potential at which constriction was initiated in the presence of nifedipine was −40 ± 1.8 mV (n = 6).
Together these data demonstrate that both vascular tone and vasomotion are voltage dependent processes, but only vasomotion, and not vascular tone, depends on calcium influx through L-type VDCCs. In contrast to the selective L-type VDCC blocker, nifedipine, the dihydropyridine, nimodipine, produced effects on both vasomotion and vascular tone.
Strong mRNA expression for CaV1.2 (n=3), CaV1.3 (n=3), CaV3.1 (n=3), and CaV3.2 (n=3) was detected in basilar artery preparations, while CaV2.3 (n=5) was weakly expressed (Figure 4). CaV1.1, CaV1.4 (n = 3), CaV2.1, CaV2.2 (n = 4) and CaV3.3 (n = 3) were strongly expressed in rat skeletal muscle, retina, cerebellum, brain cortex and striatum, respectively, but were absent from the basilar artery (Figure 4).
Figure 4. mRNA expression of VDCC subtypes in the basilar artery. CaV1.2, CaV1.3, CaV3.1 and CaV3.2 were strongly expressed in the basilar artery. CaV2.3 was weakly expressed. Lanes: +RT, basilar artery containing RNA and Superscript II; −RT, basilar artery containing RNA but no Superscript II; CT, positive control; W, control PCR without cDNA. Rat brain cortex was used as positive control for the PCR reactions for CaV1.2, CaV1.3, CaV2.2, CaV2.3, CaV3.1 and CaV3.2, skeletal muscle for CaV1.1; retina for CaV1.4; cerebellum for CaV2.1; brain striatum for CaV3.3.
Quantitative PCR showed that the order of expression was CaV3.1>CaV1.2>CaV1.3>CaV3.2>CaV2.3 in both the main and in the lateral branches (Table 5). Expression of CaV3.1 was significantly higher than that of the other 4 channels in both the main basilar artery and in the side branches. All of the channels tended to be more highly expressed in the lateral branches than in the main basilar artery, although this difference did not reach statistical significance.
| CaV subtype | Basilar Artery | Lateral Branches |
| CaV1.2 | 1086 ±157 (3) * | 3550 ± 1541 (3) * |
| CaV1.3 | 475 ± 79 (3) * | 679 ± 478 (3) * |
| CaV2.3 | 45 ± 10 (3) * | 48 ± 33 (3) * |
| CaV3.1 | 10730 ± 329 (3) | 14820 ± 4895 (3) |
| CaV3.2 | 139 ± 33 (3) * | 367 ± 113 (3) * |
Strong staining for Cav3.1 was found intracellularly adjacent to the nucleus and in the cell membranes of the smooth muscle cells of the basilar artery and its smaller side branches (Figure 5A). Clear punctate staining for Cav1.2 was also found in the smooth muscle cell membranes (Figure 5C). Weak immunoreactivity could be detected for Cav3.2 (Figure 5E), while no staining was found for Cav1.3 (data not shown). In the case of Cav2.3, the staining was confined to the very outer limit of the vessel and was therefore not considered to be expressed in the smooth muscle (Figure 5G). Staining was abolished following incubation of the antibodies against Cav3.1, Cav1.2 and Cav2.3 with the appropriate antigenic peptide (Figure 5B, D, H) and greatly reduced for the antibodies against Cav3.2 (Figure 5F). Similar results were obtained for the 2 different antibodies directed against Cav3.1 and Cav3.2. These data showed that the L- and T-type VDCCs, Cav1.2 and Cav3.1, were the most strongly expressed subtypes in the smooth muscle cells of the basilar artery and branches.
Figure 5. Protein expression of VDCC subtypes in the basilar artery. Strong staining for Cav3.1 was found intracellularly near the nucleus (arrowhead) and in the cell membrane (white arrow) of the smooth muscle cells of the basilar artery branches (A). Punctate staining was also found in the cell membrane for Cav1.2 (white arrow, C). Weaker staining for Cav3.2 (E) could be detected (white arrows). Staining for Cav2.3 appeared to be confined to the outer limits of the vessel (G). Staining for all antibodies was abolished or greatly reduced by preincubation in the appropriate antigenic peptide (B, D, F, H). Transversely oriented smooth muscle cells were identified by nuclear staining with propidium iodide.
Application of the T-type VDCC blocker mibefradil (1μM) abolished vasomotion (n = 13) and relaxed branches of the basilar artery (121 ± 3.4 % RVD in control; P < 0.05; paired t-test, n = 13; Figure 6A; Table 4). Mibefradil decreased wall calcium levels (79 ± 6.5 % F340/380 in control; P < 0.05; paired t-test, n = 5; not shown), abolished calcium oscillations in smooth muscle cells (n = 3) and hyperpolarized the cell membrane (control: −40 ± 0.4 mV; mibefradil: −60 ± 3.7 mV; P < 0.05; paired t-test, n = 5; Figure 6A).
Figure 6. Effect of T- type VDCC
blockers on tone, membrane potential and [Ca]i.
Application of
mibefradil (1 μM,
A) and pimozide (10 μM, B) abolished vasomotion, relaxed and
hyperpolarized basilar arteries, abolished oscillations of calcium in
individual smooth muscle
cells and
decreased basal calcium levels. C.
After arteries had been relaxed with 2-APB (60 μM) and L-type
VDCCs had been blocked with nifedipine (1 μM), application of
40 mM KCl produced constriction of basilar arteries (control). This
contraction was significantly reduced by mibefradil (1 μM). D.
Constriction evoked by 40 mM KCl was similarly attenuated by a high,
non-selective concentration of nickel chloride (1 mM).
* P < 0.05 significantly different
from the corresponding control.
The T-type VDCC blocker pimozide (10 μM) also relaxed (109 ± 1.8 % RVD in control; P < 0.05; paired t-test, n = 14), and hyperpolarized basilar arteries (control: −43 ± 2.8 mV; pimozide: −56 ± 2.6 mV; P < 0.05; paired t-test, n = 5; Figure 6B; Table 4), decreased basal calcium (94 ± 1.7 % F340/380 in control; P < 0.05; paired t-test, n = 6), and decreased the frequency of contractions (control: 15.8 ± 1.1 contractions per minute; pimozide: 4.8 ± 2.1 contractions per minute; P < 0.05; paired t-test, n = 14). In 9 of 14 experiments vasomotion was completely abolished, and in 4 of 6 experiments measuring calcium, oscillations in individual smooth muscle cells were abolished.
Incubation with the T-type VDCC blocker flunarizine (100 μM) produced relaxation (106 ± 1.1 % RVD in control; P < 0.05; paired t-test, n = 7), significantly decreased basal calcium levels (94 ± 1.7 % F340/380 in control; P < 0.05; paired t-test, n = 7) and the frequency of vasomotion (control: 13.7 ± 1.4 contractions per minute; flunarizine: 1.3 ± 0.9 contractions per minute; P < 0.05; paired t-test, n = 7; Table 4). In 5 out of 7 experiments vasomotion was completely abolished.
Since CaV3.1 and CaV3.2 VDCCs were both expressed in the basilar microcirculation, low concentrations of NiCl2 (100μM) were used to differentiate between their actions, since the IC50 for CaV3.2 channels is 13 μM while the IC50 for CaV3.1 is 250 μM.37 At this concentration, there was no significant effect on arterial tone (102 ± 1.9 % RVD in control; P > 0.05; n = 10) or membrane potential (control: −49 ± 2.2 mV; n = 6; 100 μM NiCl2: −47 ± 3.9 mV; n = 6; P > 0.05), although the frequency of vasomotion was reduced (frequency control: 16.6 ± 0.8 oscillations per minute; n = 10; 100 μM NiCl2: 8.0 ± 1.9 oscillations per minute; n = 10; P < 0.05; Table 4), suggesting that CaV3.2 VDCCs were not involved. A higher, non-selective concentration of nickel chloride (1 mM) abolished vasomotion (P < 0.05; n = 7) and relaxed arteries (108 ± 2.8 % RVD in control; P < 0.05; n = 7), showing a trend towards hyperpolarization (control: −49 ± 2.2 mV; n = 6; 1 mM NiCl2: −55 ± 5.9 mV; n = 3; P > 0.05; unpaired t-test).
Taken together, the results demonstrate a role for T-type VDCCs, of the CaV3.1 subtype, in providing the calcium influx necessary for the maintenance of vascular tone in the rat basilar artery.
In these experiments, arteries were relaxed by inhibiting IP3 receptors with 2-APB (60 μM44) or by blocking the phospholipase C pathway with U73122 (10 μM). In the presence of nifedipine (1 μM) to block L-type channels, 2-APB relaxed the arteries (106 ± 1.6 % RVD in control, P < 0.05). Subsequent application of Krebs solution containing 40 mM KCl, in the continued presence of 2-APB and nifedipine, produced vasoconstriction which was significantly reduced by mibefradil (1 μM; Control: 7.9 ± 1.9 % RVD in 2-APB and nifedipine; mibefradil: 3.4 ± 0.9 % RVD in 2-APB and nifedipine; P < 0.05, n = 4; Figure 6C) or a non specific concentration of nickel chloride (1mM; Control: 9.0 ± 1.8 % RVD in 2-APB and nifedipine; NiCl2: 3.5 ± 1.3 % RVD in 2-APB and nifedipine; P < 0.05, n = 5; Figure 6D). After relaxation with U73122, in the presence of nifedipine, 40 mM KCl evoked vasoconstriction (15 ± 3.5 % RVD, n = 7), which was also significantly reduced following incubation in mibefradil (1 μM; 9 ± 3.3 % RVD in U73122, nifedipine and mibefradil; P < 0.05; n = 7).
These data suggest that vasoconstriction evoked by depolarization results from calcium influx through nifedipine-insensitive VDCCs.
In order to identify whether the T-type VDCCs expressed in the basilar artery were typical CaV3.1 and CaV3.2 channels, we cloned and sequenced domains I, II and the I-II linker regions. The location of the primers in the CaV3.1 sequence is shown in Figure 7. Primers used for CaV3.2 were located in similar regions.
Figure 7. Schematic representation of the aminoacid structure of CaV3.1. 1F and 1R denote location of forward and reverse primers, respectively, against domain I. LF and LR denote location of forward and reverse primers, respectively, against I-II Linker. 2F and 2R denote location of forward and reverse primers, respectively, against domain II. Rectangle with horizontal lines represents location of alpha interaction domain in high voltage activated calcium channels. Dotted line represents the approximate location and size of deletion in novel splice variant. Double-ended arrow represents approximate size (left) and location (right) of insertion in splice variant. Domain IV not shown. Modified from Perez-Reyes, 2003, Physiol. Rev. 83:117-61.
Sequencing of domain I of CaV3.1 revealed the expected 1215 bp fragment, including the last 63 amino acids of the N-terminus and the first 27 amino acids of the I-II linker. This showed 100% homology with CaV3.1 sequences, GenBank accession numbers AF125161 and AF290212.
PCR of the I-II linker of CaV3.1, from 27 amino acids before the intramembrane portion between IS5 and IS6 to 12 amino acids before the beginning of domain II revealed 2 main fragments of 1269 bp (expected) and 867 bp which were sequenced. The 1269 bp fragment was 100% homologous with sequences, GenBank accession numbers AF125161 and AF290212. The 867 bp sequence was 100% homologous with CaV3.1 sequences, GenBank accession numbers AF125161 and AF290212, except that it lacked the last 402 nucleotides of exon 9. This exclusion encodes 134 amino acids, beginning 114 amino acids into the I-II linker (Figure 7, dotted region).
PCR of domain II of CaV3.1 from the last 17 amino acids of the I-II linker to the start of the II-III linker revealed 2 bands of 856 bp and 925 bp. Sequencing showed that the 856 bp band was 100% homologous with GenBank accession number AF290212, while the 925 bp band was 100% homologous with GenBank accession number AF125161, isolated from insulin-secreting cells. The 856 bp sequence lacks exon 15, which is present in the 925 bp band. This exon encodes for 23 amino acids beginning 6 amino acids into the II-III linker (see double ended arrow indicating insertion in Figure 7).
PCR of domains I, II and the I-II linker of CaV3.2 revealed bands with the expected sizes of 1267 bp, 1014 bp, and 1069 bp, respectively, and were homologous with the CaV3.2 sequence, GenBank accession no AF290213.
The present study has shown a differential involvement of VDCC subtypes in cerebrovascular function; L-type VDCCs were essential for vasomotion, while non-L-type VDCCs, with pharmacology matching that of T-type channels, controlled vascular tone. Consistent with this physiological data, real-time PCR and immunohistochemistry demonstrated expression of both L- and T-type channels, with the most highly expressed subtypes in both the main basilar artery and its smaller side branches being the Cav1.2 and Cav3.1. Since the membrane potential of the smooth muscle cells of the rat basilar artery in the present study was around −45mV, a value similar to that of cerebral arteries subjected to intraluminal pressure,45,46 we conclude that the T-type channels expressed in these vessels must be activated and inactivated at more depolarized potentials, similar to the T-type channels identified in other blood vessels.1
While incubation in the L-type VDCC antagonist, nifedipine, abolished vasomotion, it had no effect on vascular tone of rat basilar arteries.12 In contrast, injection of small hyperpolarizing current steps into short arterial segments in the presence of supramaximal concentrations of nifedipine produced immediate relaxation and loss of vasomotion, suggesting that non L-type VDCCs control vascular tone. In a comparable fashion, depolarization of quiescent arteries led to vasoconstriction, despite the presence of nifedipine, but did not produce vasomotion. Taken together, the results support the conclusion that L-type VDCCs are essential for vasomotion but non L-type channels are instrumental in determining vascular tone in these cerebral arteries.
Support for a role of non L-type VDCCs came from our quantitative PCR studies which revealed strong expression of two L-type (CaV1.2 and CaV1.3) and two T-type (CaV3.1 and CaV3.2) VDCC channels in the rat basilar artery and its branches, with similar relative mRNA expression showing CaV3.1 > CaV1.2 > CaV1.3 > CaV3.2 > CaV2.3. At the protein level, CaV3.1 and CaV1.2 were both clearly expressed in the vascular smooth muscle cells, while much lower levels of CaV3.2 were found, CaV1.3 was not detected and CaV2.3 was confined to the surface of the vessel. We found no evidence for expression of N-type channels (CaV2.2) as described in the dog basilar artery,17 or of P/Q-type channels (CaV2.1) as found in rat renal arterioles47,48 suggesting that further variation may occur between vascular beds and species.
While nifedipine had no effect on basilar tone, the subsequent addition of nimodipine evoked relaxation and hyperpolarization, suggesting a non-specific action on other VDCCs, as previously described.23-26 Three putative T-type channel antagonists, mibefradil, pimozide and flunarizine, produced a similar effect on membrane potential and vascular tone. In the absence of significant expression of other high voltage activated VDCCs, the data support a role for T-type channels in this vessel. Since CaV3.2 VDCCs are more sensitive to nickel chloride than are CaV3.1 VDCCs,37 we tested low concentrations of nickel chloride but found no effect on either vascular tone or membrane potential. We therefore propose that vascular tone in the rat basilar artery and its microcirculation is provided by influx of calcium through nifedipine-insensitive VDCCs with pharmacology matching that of T-type CaV3.1 channels.
We found that depolarization-induced vasoconstriction produced by 40mM KCl, in the presence of L-type channel blockade, was initiated at a membrane potential of −40 mV. Furthermore, this depolarization-induced constriction was significantly reduced by mibefradil in the continued presence of dihydropyridines. Although classical T-type channels would be expected to be closed at these potentials,1 T-type channels exhibiting a maximal window current around −37mV have been characterized in smooth muscle cells of the dog basilar artery, along with mRNA and protein for CaV3.1 and CaV3.3.17 Such channels could therefore contribute to cerebrovascular tone as they would be open at physiologically relevant membrane potentials. Indeed, the T-type currents found in the dog basilar artery were inhibited by nimodipine and mibefradil which also produced relaxation of arterial segments.17 Whether T-type channels are expressed and are functional in other parts of the cerebral circulation remains to be determined.
A nifedipine-insensitive VDCC with high voltage activation and possessing pharmacological properties resembling T-type channels has been described in terminal mesenteric arterioles.25,26,49-51 While the expression of T-type channels was not investigated in these studies,25,26 others have shown that small mesenteric arterioles of <40 μm express T-, but not L-type, channels which are responsible for local and conducted vasoconstriction and depolarization-induced calcium influx.52,53 It seems unlikely, however, that these peripherally located T-type channels in the microcirculation are responsible for systemic blood pressure regulation since conditional knockout of CaV1.2 with the Cre/lox site specific recombination system, and tamoxifen as the inducer, produced a severe reduction in blood pressure and depolarization-induced constriction was absent in resistance sized (100-150 μm) skeletal muscle arteries.54 Nevertheless, T-type VDCCs have also been implicated in the function of the renal microcirculation and a role in renal injury has been proposed.55,56
Cloning and sequencing of domains I to II of CaV3.1 and CaV3.2 failed to identify any alterations to transmembrane segments, defined in previous mutagenesis studies,57 that could account for a shift in voltage dependence of activation towards more depolarized potentials. Indeed, in the case of CaV3.2, the entire region encompassing domains I, II and the I-II linker was identical to the sequences available in international databases. In contrast, sequencing of CaV3.1 demonstrated expression of 2 splice variants in the linker regions. One was an insertion in the II-III linker, previously described in CaV3.1 channels isolated from insulin-secreting cells,58 while the other was a novel deletion in the I-II linker.
The I-II linker has been shown to be important for the binding of auxiliary subunits in high voltage activated channels30 and for modulation of surface expression.31 However, the absence of any modification to the region in the I-II linker corresponding to the alpha interaction domain in high voltage activated channels suggests that the channels expressed in the basilar artery are no more regulated by auxiliary subunits than are normal T-type channels.59 In contrast, the novel deletion in the I-II linker of CaV3.1 spans a 402 bp segment encoding 134 amino acids located in a region homologous to that shown recently to modulate surface expression of CaV3.2 channels.31 Whether expression of this novel splice variant results in increased surface expression and hence the size of the window current of the CaV3.1 channels is yet to be determined.
The insertion of 23 amino acids encoded by exon 15 after the end of domain II of CaV3.1 was identical to a splice variant isolated from insulin-secreting cells.58 Interestingly, this channel has higher voltage activation and window current than other T-type channels58 and could therefore contribute to the properties found in the present study. Amplification of cDNA from the end of domain I to the end of domain II indicates that these two splice variants may occur in the same and separate transcripts (unpublished observations). Future studies are required to determine the relative protein expression and properties of these splice variants.
We conclude that non L-type VDCCs are responsible for the maintenance of vascular tone of the rat basilar artery by providing a persistent inward current at physiological membrane potentials. Our molecular and immunohistochemical data indicate that L- and T-type channels are the predominant VDCCs expressed in this vessel and our pharmacological data support the involvement of CaV3.1. Cloning studies have shown that some of the CaV3.1 channels may contain splice variations which may modify their properties or expression. T-type channels may therefore provide a potential target for therapeutic control of cerebrovascular tone during vasospastic conditions.
Work was supported by International and ANU Postgraduate Research Scholarships to MN-G and project grants from the National Health and Medical Research Council (471420) and Australian Research Council (DP0663818) to CEH.
1. Perez-Reyes E. Molecular physiology of low-voltage-activated t-type calcium channels. Physiol. Rev. 2003; 83: 117-61.
2. Lacinová L. Voltage-dependent calcium channels. Gen. Physiol. Biophys. 2005; 24 Suppl 1: 1-78.
3. Gerthoffer WT, Shafer PG, Taylor S. Selectivity of phenytoin and dihydropyridine calcium channel blockers for relaxation of the basilar artery. J. Cardiovasc. Pharmacol. 1987; 10: 9-15.
4. Usui H, Akimoto Y, Kurahashi K, et al. Effects of nitroglycerin on stable thromboxane A2 analogue-induced, nifedipine-resistant contraction in canine basilar artery. Jpn. J. Pharmacol. 1990; 54: 237-40.
5. Varsos VG, Liszczak TM, Han DH, et al. Delayed cerebral vasospasm is not reversible by aminophylline, nifedipine, or papaverine in a "two-hemorrhage" canine model. J. Neurosurg. 1983; 58: 11-7.
6. Katori E, Ohta T, Nakazato Y, Ito S. Vasopressin-induced contraction in the rat basilar artery in vitro. Eur. J. Pharmacol. 2001; 416: 113-21.
7. Teixeira CE, Priviero FB, Todd J, Jr., Webb RC. Vasorelaxing effect of BAY 41-2272 in rat basilar artery: involvement of cGMP-dependent and independent mechanisms. Hypertension 2006; 47: 596-602.
8. Nakayama K. Calcium-dependent contractile activation of cerebral artery produced by quick stretch. Am. J. Physiol. 1982; 242: H760-8.
9. Hogestatt ED, Andersson KE, Edvinsson L. Effects of nifedipine on potassium-induced contraction and noradrenaline release in cerebral and extracranial arteries from rabbit. Acta Physiol. Scand. 1982; 114: 283-96.
10. Asano M, Aoki K, Suzuki Y, Matsuda T. Effects of Bay k 8644 and nifedipine on isolated dog cerebral, coronary and mesenteric arteries. J. Pharmacol. Exp. Ther. 1987; 243: 646-56.
11. Omote M, Mizusawa H. Interaction between the L-type Ca2+ channel and the Ca2+-activated K+ channel in the fluctuating myogenic contraction in the rabbit basilar artery. Jpn. J. Physiol. 1996; 46: 353-6.
12. Haddock RE, Hill CE. Differential activation of ion channels by inositol 1,4,5-trisphosphate (IP3)- and ryanodine-sensitive calcium stores in rat basilar artery vasomotion. J. Physiol. 2002; 545: 615-27.
13. Alborch E, Salom JB, Perales AJ, et al. Comparison of the anticonstrictor action of dihydropyridines (nimodipine and nicardipine) and Mg2+ in isolated human cerebral arteries. Eur. J. Pharmacol. 1992; 229: 83-9.
14. Forsman M, Fleischer JE, Milde JH, Steen PA, Michenfelder JD. The effects of nimodipine on cerebral blood flow and metabolism. J. Cereb. Blood Flow Metab. 1986; 6: 763-7.
15. Fujii K, Heistad DD, Faraci FM. Ionic mechanisms in spontaneous vasomotion of the rat basilar artery in vivo. J. Physiol. 1990; 430: 389-98.
16. Muller-Schweinitzer E, Neumann P. In vitro effects of calcium antagonists PN 200-110, nifedipine, and nimodipine on human and canine cerebral arteries. J. Cereb. Blood Flow Metab. 1983; 3: 354-61.
17. Nikitina E, Zhang ZD, Kawashima A, et al. Voltage-dependent calcium channels of dog basilar artery. J. Physiol. 2007; 580: 523-41.
18. Peroutka SJ, Banghart SB, Allen GS. Relative potency and selectivity of calcium antagonists used in the treatment of migraine. Headache 1984; 24: 55-8.
19. Towart R. The selective inhibition of serotonin-induced contractions of rabbit cerebral vascular smooth muscle by calcium-antagonistic dihydropyridines. An investigation of the mechanism of action of nimodipine. Circ. Res. 1981; 48: 650-7.
20. Tsuji T, Cook DA. Effect of nimodipine on canine cerebrovascular responses to 5-hydroxytryptamine and potassium chloride after exposure to blood. Stroke 1989; 20: 105-11.
21. White RP, Cunningham MP, Robertson JT. Effect of the calcium antagonist nimodipine on contractile responses of isolated canine basilar arteries induced by serotonin, prostaglandin F2a, thrombin, and whole blood. Neurosurgery 1982; 10: 344-8.
22. Alborch E, Salom JB, Torregrosa G. Calcium channels in cerebral arteries. Pharmacol. Ther. 1995; 68: 1-34.
23. Heady TN, Gomora JC, Macdonald TL, Perez-Reyes E. Molecular pharmacology of T-type Ca2+ channels. Jpn. J. Pharmacol. 2001; 85: 339-50.
24. Randall AD, Tsien RW. Contrasting biophysical and pharmacological properties of T-type and R-type calcium channels. Neuropharmacology 1997; 36: 879-93.
25. Morita H, Cousins H, Onoue H, Ito Y, Inoue R. Predominant distribution of nifedipine-insensitive, high voltage-activated Ca2+ channels in the terminal mesenteric artery of guinea pig. Circ. Res. 1999; 85: 596-605.
26. Morita H, Shi J, Ito Y, Inoue R. T-channel-like pharmacological properties of high voltage-activated, nifedipine-insensitive Ca2+ currents in the rat terminal mesenteric artery. Br. J. Pharmacol. 2002; 137: 467-76.
27. Mecca TE, Love SD. Comparative cardiovascular actions of clentiazem, diltiazem, verapamil, nifedipine, and nimodipine in isolated rabbit tissues. J. Cardiovasc. Pharmacol. 1992; 20: 678-82.
28. Zuccarello M, Boccaletti R, Tosun M, Rapoport RM. Role of extracellular Ca2+ in subarachnoid hemorrhage-induced spasm of the rabbit basilar artery. Stroke 1996; 27: 1896-902.
29. Firat MM, Gelebek V, Orer HS, Belen D, Firat AK, Balkanci F. Selective intraarterial nimodipine treatment in an experimental subarachnoid hemorrhage model. AJNR Am. J. Neuroradiol. 2005; 26: 1357-62.
30. Arias JM, Murbartian J, Vitko I, Lee JH, Perez-Reyes E. Transfer of b-subunit regulation from high to low voltage-gated Ca2+ channels. FEBS Lett. 2005; 579: 3907-12.
31. Vitko I, Bidaud I, Arias JM, Mezghrani A, Lory P, Perez-Reyes E. The I-II loop controls plasma membrane expression and gating of Cav3.2 T-type Ca2+ channels: a paradigm for childhood absence epilepsy mutations. J. Neurosci. 2007; 27: 322-30.
32. Neild TO. Measurement of arteriole diameter changes by analysis of television images. Blood Vessels 1989;26:48-52.
33. Mishra SK, Hermsmeyer K. Selective inhibition of T-type Ca2+ channels by Ro 40-5967. Circ. Res. 1994; 75: 144-8.
34. McDonough SI, Bean BP. Mibefradil inhibition of T-type calcium channels in cerebellar purkinje neurons. Mol. Pharmacol. 1998; 54: 1080-7.
35. Feng MG, Navar LG. Angiotensin II-mediated constriction of afferent and efferent arterioles involves T-type Ca2+ channel activation. Am. J. Nephrol. 2004; 24: 641-8.
36. Santi CM, Cayabyab FS, Sutton KG, et al. Differential inhibition of T-type calcium channels by neuroleptics. J. Neurosci. 2002; 22: 396-403.
37. Lee JH, Gomora JC, Cribbs LL, Perez-Reyes E. Nickel block of three cloned T-type calcium channels: low concentrations selectively block α1H. Biophys. J. 1999; 77: 3034-42.
38. Trimmer JS, Rhodes KJ. Localization of voltage-gated ion channels in mammalian brain. Annu. Rev. Physiol. 2004; 66: 477-519.
39. Talley EM, Cribbs LL, Lee JH, Daud A, Perez-Reyes E, Bayliss DA. Differential distribution of three members of a gene family encoding low voltage-activated (T-type) calcium channels. J. Neurosci. 1999; 19: 1895-911.
40. Lau FC, Abbott LC, Rhyu IJ, Kim DS, Chin H. Expression of calcium channel α1A mRNA and protein in the leaner mouse (tgla/tgla) cerebellum. Brain Res. Mol. Brain. Res. 1998; 59: 93-9.
41. McRory JE, Santi CM, Hamming KS, et al. Molecular and functional characterization of a family of rat brain T-type calcium channels. J. Biol. Chem. 2001; 276: 3999-4011.
42. Gasteiger E, Gattiker A, Hoogland C, Ivanyi I, Appel RD, Bairoch A. ExPASy: The proteomics server for in-depth protein knowledge and analysis. Nucleic. Acids Res. 2003; 31: 3784-8.
43. Brueggemann LI, Martin BL, Barakat J, Byron KL, Cribbs LL. Low voltage-activated calcium channels in vascular smooth muscle: T-type channels and AVP-stimulated calcium spiking. Am. J. Physiol. Heart Circ. Physiol. 2005; 288: H923-35.
44. Bilmen JG, Michelangeli F. Inhibition of the type 1 inositol 1,4,5-trisphosphate receptor by 2-aminoethoxydiphenylborate. Cell Signal 2002; 14: 955-60.
45. Knot HJ, Nelson MT. Regulation of arterial diameter and wall Ca2+ in cerebral arteries of rat by membrane potential and intravascular pressure. J. Physiol. 1998; 508: 199-209.
46. Harder DR. Pressure-induced myogenic activation of cat cerebral arteries is dependent on intact endothelium. Circ. Res. 1987; 60: 102-7.
47. Hansen PB, Jensen BL, Andreasen D, Friis UG, Skott O. Vascular smooth muscle cells express the α1A subunit of a P-/Q-type voltage-dependent Ca2+ channel, and It is functionally important in renal afferent arterioles. Circ. Res. 2000; 87: 896-902.
48. Andreasen D, Friis UG, Uhrenholt TR, Jensen BL, Skott O, Hansen PB. Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes. Hypertension 2006; 47: 735-41.
49. Itonaga Y, Nakajima T, Morita H, et al. Contribution of nifedipine-insensitive voltage-dependent Ca2+ channel to diameter regulation in rabbit mesenteric artery. Life Sci. 2002;72:487-500.
50. Morita H, Sharada T, Takewaki T, Ito Y, Inoue R. Multiple regulation by external ATP of nifedipine-insensitive, high voltage-activated Ca2+ current in guinea-pig mesenteric terminal arteriole. J. Physiol. 2002; 539: 805-16.
51. Evans J, Gelband CH. A novel Ca2+ channel in vascular smooth muscle? Circ. Res. 1999; 85: 651-2.
52. Gustafsson F, Andreasen D, Salomonsson M, Jensen BL, Holstein-Rathlou N. Conducted vasoconstriction in rat mesenteric arterioles: role for dihydropyridine-insensitive Ca2+ channels. Am. J. Physiol. Heart Circ. Physiol. 2001; 280: H582-90.
53. Jensen LJ, Salomonsson M, Jensen BL, Holstein-Rathlou NH. Depolarization-induced calcium influx in rat mesenteric small arterioles is mediated exclusively via mibefradil-sensitive calcium channels. Br. J. Pharmacol. 2004; 142: 709-18.
54. Moosmang S, Schulla V, Welling A, et al. Dominant role of smooth muscle L-type calcium channel Cav1.2 for blood pressure regulation. Embo. J. 2003; 22: 6027-34.
55. Feng MG, Li M, Navar LG. T-type calcium channels in the regulation of afferent and efferent arterioles in rats. Am. J. Physiol. Renal Physiol. 2004; 286: F331-7.
56. Hayashi K, Wakino S, Homma K, Sugano N, Saruta T. Pathophysiological significance of T-type Ca2+ channels: role of T-type Ca2+ channels in renal microcirculation. J. Pharmacol. Sci. 2005; 99: 221-7.
57. Li J, Stevens L, Klugbauer N, Wray D. Roles of molecular regions in determining differences between voltage dependence of activation of CaV3.1 and CaV1.2 calcium channels. J. Biol. Chem. 2004; 279: 26858-67.
58. Zhuang H, Bhattacharjee A, Hu F, et al. Cloning of a T-type Ca2+ channel isoform in insulin-secreting cells. Diabetes 2000; 49: 59-64.
59. Perez-Reyes E. Molecular characterization of T-type calcium channels. Cell Calcium 2006; 40: 89-96.